Cole & Joe's Research Paper

Cole Wilson & Joe Lockett
Genetics
Developmental Genetics Paper
3-13-2009

Dwarfism: The Big Issue to a “Small” Problem
Many people around the world suffer from different skeletal diseases. These diseases can severely disfigure a person making them incapable of doing simple tasks or they can inhibit certain features of someone such as bone growth. Achondroplasia, or dwarfism, is the most common form of skeletal dysplasia. (Murdoch). For every 15,000 births in the world a child is born with this skeletal disease. (Rousseau) It is easily noticeable with features such as stubby limbs, short stature, and large head. There are few treatments to correct this genetic abnormality. Treatment or no, patients of achondroplasia have adapted to live in a world much taller than their own.
_________

Achondroplasia
Achondroplasia is a genetic congenital disorder. This disorder causes abnormal growth in cartilage and fibrous connective tissue. Slow development of cartilage, ligaments, and bone result in the minimal gain in height seen in all dwarfs. The abnormal growth is the cause of a single point mutation found in the 4th chromosome in the human genome. In dwarfs a missense mutation occurs at the 380th codon resulting in the change of a protein sequence. In the 380th codon (GGG) the first G (guanine) commonly in dwarfs mutates to adenine and in few cases to cytosine. (Rousseau) This in the protein sequence what was once glycine is now agrinine. (See Figure 1) (Bellus)
Figure 1 4th Chromosome Mutation
TATGCAGGCATCCTCAGCTACGGGGTGGGCTTCTTCCTGTTCATCCTGGTGGTGGCGGCTGTGACGCTCTGC
Y A G I L S Y G V G F F L F I L V V A A V T L C

ATCCTCAGCTACGGGGTGGGCTTCTTC
A
C

This mutation affects the fibroblast-growth-factor receptor gene (FGFR3). There are four Fibroblast growth factor receptors (FGFRs). FGFRs are a group of 4 transmembrane glycoproteins. FGFR1, FGFR2, and FGFR3 undergo alternative exon splicing in an immunoglobulin-like domain to make different specific duties. (Bellus) FGFR-3 is a protein that regulates cell growth and division. Along with other interactions, FGFR-3 is important in developing connective tissue, namely bone and cartilage. If a mutation occurs in the FGFR-3 protein, Growth plates can be severely inhibited. This is the cause of the very short stature in dwarfs. Proximal bones are not as affected as distal bones are in achondroplasia. This is evident in the fact that most dwarves have large torsos and head but short arms and legs. An abnormal curvature of the spinal column leads to a prominence in the buttocks. (Murdoch) Because the spine is narrowed but still encases a regular spine, there is a lot of pressure built-up on the spinal cord. People with this disorder have a high chance for developing neurological complications, due to the compression of the spine. This along with other problems often leads to death in infants. Some patients of the disease suffer from repeating acute attacks of increased intracranial pressure, possibly provoked by slight head injuries and infections. (Bergstrom)

Treatments
Although many of these little people are content with their bodies, some are not. For this reason there are treatments that allow the individuals to live as happy of lives as possible. Human Growth Hormone (hGH) Treatment is the most popular of them out there as well as being the most useful method for improvement of severe growth retardation in individuals with achondroplasia11. It is usually done at a period of the individual’s life just before he/she hits puberty. This is because the body naturally makes enormous gains at this stage of life anyways, so by issuing the hGH at this point the bones are not harmed or damaged due to rapid growth. Treatments usually last about six months and on average the individual being treated can expect to grow between 3.6-7.0 centimeters per year (while on treatment), and approximately 2.0-4.3 centimeters per year (post treatment)12. Another more drastic treatment can be done through a surgical procedure that involves a physical lengthening of the long bones in the arms and legs. Ilizarov’s Method is one of many and has been proven successful for individuals suffering from Achondroplasia. The lengthening of the long bones is accomplished by partially cutting the cortex, leaving the medulla intact and with the use of a special apparatus (see Figure 2), bone matter is regenerated between the two segments and results in an overall lengthening of the bone3. There are other methods used in the lengthening of bones, this is one example.
Fig. 2 Bone Extension Instrument

Conclusion
It is because of the in depth study of Genetics that these individuals of smaller stature can permanently change their physical appearance. Those who choose not to can still carry out the tasks that are involved in everyday life, although some are harder to accomplish than others. Thanks to geneticists, we now know what it is exactly that causes this genetic disorder and can administer effective treatments to those individuals diagnosed with achondroplasia.

References
1 Aviezer D. Golembo M. Yayon A.. "Fibroblast growth factor receptor-3 as a therapeutic
target for Achondroplasia—genetic short limbed dwarfism.." Curr Drug Targets 04 July. 2003. 10 March. 2009 <http://www.be-md.ncbi.nlm.nih.gov/pubmed/12816345?ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_Discovery_RA&linkpos=5&log$=relatedreviews&logdbfrom=pubmed>.
2Bergstrom, K., U. Laurent, and P. O. Lundberg. "NEUROLOGICAL SYMPTOMS IN

ACHONDROPLASIA." Acta Neurologica Scandinavica 47 (2009): 59-70. Wiley Interscience. Jan. 2009. Mar. 2009 <http://www.interscience.wiley.com>.

3Cattaneo, R. Villa, A. Catagni, M. Tentori L.. International Orthopaedics. Lecco, Italy:

Springer-Verlag, 1988.

4Coffin, J. D., R. Z. Florkiewicz, J. Neumann, T. Mort-Hopkins, G. W. Dorn II, P.

Lightfoot, R. German, P. N. Howles, A. Kier, and B. A. O'Toole. "Abnormal bone growth and selective translational regulation in basic fibroblast growth factor (FGF-2) transgenic mice." Dec. 1995. PubMed. <http://www.pubmed.gov>.

5Dwarfism. 12 March. 2009. 12 March. 2009 <http://en.wikipedia.org/wiki/Dwarfism>.
6Gary A. Bellus,' Timothy W. Hefferon,' Rosa 1. Ortiz de Luna,"* Jacqueline T. Hecht,2
William A. Horton,3 Mirta Machado,3 llkka Kaitila,4 lain McIntosh,' and Clair A. Francomano' S. "Achondroplasia Is Defined by Recurrent G380R Mutations of FGFR3." American Journal of Human Genetics 1995. 10 March. 2009 http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=1801129&blobtype=pdf

.
7Hecht, J T. Francomono, C A. Horton, W A. Annegers, J F.. "Mortality in
Achondroplasia." The American Journal of Human Genetics September. 1987. 10 March. 2009 <http://www.pubmedcentral.nih.gov/pagerender.fcgi?artid= 1684180&pageindex=7#page>.
8Melanie K.Webster and Daniel J.Donoghuel. "Constitutive Activation of Fibroblast
Growth Factor Receptor 3 by the Transmembrane Domain Point Mutation found in Achondroplasia." The EMBO Journal 1996. 11 March. 2009 <http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=449970&blobtype=pdf>.

9Murdoch, J. L., B. A. Walker, J. G. Hall, H. Abbey, K. K. Smith, and V. A. MCKusick.

"Achondroplasia - a genetic and statistical survey." Annals of Human Genetics 33
(2009): 227-44. PubMed. 07 Sept. 2007. Nation Center for Biotechnology Information. Mar. 2009 <http://www.pubmed.gov>.

10Rousseau, F., J. Bonaventure, L. Legeai-Mallet, A. Pelet, J. M. Rozet, P. Maroteaux,

M. Le Merrer, and A. Munnich. "Mutations in the gene encoding fibroblast growth factor receptor-3 in achondroplasia." Nature (1994): 252-54. PubMed. Nation Center for Biotechnology Information. Mar. 2009 <http://www.pubmed.gov>.

11Seino, Y., Y. Yamanaka, M. Shinohara, S. Ikegami, M. Koike, M. Miyazawa, M. Inoue,

T. Moriwake, and H. Tanaka. "Growth Hormone Therapy in Achondroplasia." Growth Hormone Therapy in Achondroplasia 53 (200). Hormone Research. 2000. Karger. Mar. 2009 <http://www.karger.com>.

12Shohat, M. Tick, D. Barakat, S. Bu, X. Melmed, S. Rimoin, DL.. "Short-term
Recombinant Human Growth Hormone Treatment Increases Growth Rate in Achondroplasia." Journal of Clinical Endocrinology & Metabolism 1996. 11 March. 2009 <http://jcem.endojournals.org>.

Unless otherwise stated, the content of this page is licensed under Creative Commons Attribution-ShareAlike 3.0 License